Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14265E12
Clone ID IST14265E12
Vector VICTR74
Project tigm

Sequence tag IST14265E12HMF1
Sequence
GGAAGAGCCGACATCGAAGGATCAAAAAGCGACGTCGCTATGAACGCTTGGCCGCCACAAGCCAGTTATCCCTGTGGTAA
CTTTTCTGACACCTCCTGCTTAAAACCCAAAAGGTCAGAAGGATCGTGAGGCCCCGCTTTCACGGTCTGTATTCGTACTG
AAAATCAAGATCAAGCGAGCTTTTGCCCTTCTGCTCCACGGGAGGTTTCTGTCCTCCCTGANCTCGCCTTANGACACCTG
CGTTACCGTTTGACAGGTGTACCGCCCCAGTCNAACTCCCCACCTGGCACTGTCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79451862..79452157 282
 
EST/CDNA Est Name
  W82547.1 - BE623158.1 - AA021762.1 - BE447185.1 - AA152523.1 - AA020629.1 - AA020359.1


Sequence tag IST14265E12HMR1
Sequence
CCTATNATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTANACCGTC
NTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCANTACGAGAGGAACCGCAN
Sequence Type genomic DNA
Unitrap ID UNI31651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123371149..123371304 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035202 (Lars2) NM_153168 leucyl-tRNA synthetase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2142973]

 
Come back to gene ENSMUSG00000035202


For any suggestions or comments, please send an email to unitrap@crg.es