Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10559G1
Clone ID IST10559G1
Vector VICTR76
Project tigm

Sequence tag IST10559G1HMF1
Sequence
ATAAAAGCAAAACACACAACAGCAAAAAACAAAACAAAACAAAACCCAAATTGACCATGTCCCAATTATCTTTATTTATT
TGTAATCTATCCTTAATTATACTCCTAATCTTTTCCTCCCTTCAATTTGCATACGGGATAGCCGACGTACTGGATGACCC
AAGCTCTAAAGGATCAGCGTCCTCAGCCCGGGAGCGCCACCACCACTTAACCCCATTAAGATGGCGGCAGCGCCCGCTCA
GCCNCTCAGGGCCGAAGCCTGCGTCACGTGACCCGCACAGCTCTCACCGNGGTGGCTGATGGGAGGTGGANATAGAACGA
GGGTGTCGGCNNTTTTGTGTCTGTTTCCTGCGGGACGCGCTGGTGGCGGTTGGTGTGGANAACTCTGCGAGTCTCTTGGG
TTTTTTGTTTTTTGNTTTTTCCAGCTTCTTTCCGCCTCTATTCTGCCTGTTCTGNANNNNNCANTTATGGGTCNCANGAA
GAAGANGCNGCTCANGCCGTGGTGCTGGTATCCTTTGNGGGGTTA
Sequence Type genomic DNA
Unitrap ID UNI14668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 80196491..80197014 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017421 (Zfp207) NP_035881 zinc finger protein 207 Gene [Source:MGI (curated);Acc:Zfp207-002]

 
Come back to gene ENSMUSG00000017421


For any suggestions or comments, please send an email to unitrap@crg.es