Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6269-NR
Clone ID PST6269-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6269-NR
Sequence
ATCACAGGCACGGATCCCTGTGTCTGGCTGATGAATTCTACCTTTTTGAAAGGAAGCACCCTCTCACTTCAGTGCTTGAG
TTAGAACCCAAGGTCACATG
Sequence Type genomic DNA
Unitrap ID UNI14841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52685856..52685955 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003868 (Ruvbl2) NM_011304 RuvB-like protein 2 Gene [Source:MGI (curated);Acc:Ruvbl2-001]

 
Come back to gene ENSMUSG00000003868


For any suggestions or comments, please send an email to unitrap@crg.es