Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14418H10
Clone ID IST14418H10
Vector VICTR74
Project tigm

Sequence tag IST14418H10HMF1
Sequence
TTAATTGTTACCTGATGTAAGAAGACCCAGTCCATTGTGGGTGTCACCATTCCCTAGGTCTAGCACCTTCTAANAGAGGA
GAAAGCCAGAANAAAGCAAGGAAAGATCACCCCCACCACCCAGTGTGGATGTGAAGCTTTAACTTCCCTGCAATAATGGA
CTGTCACCTGGAACTGTGAGTCAAAATACNCTCTTCCTTCCTCANTTGCTTTTTCTCAGGGTGCCCGTCNCAGCCANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66554195..66554429 225
 
EST/CDNA Est Name
  BY336090.1 - BY329778.1 - BY330796.1 - BY150448.1


Sequence tag IST14418H10HMR1
Sequence
TTATGAATATTGCCCCCCACCAGACATGCCCACAGGCCAACCTANACATATTTTTGGAGATGAAAACTATGCTCTAGCAA
TGTCTCCTCTTTCCAGCATATTCTTTTTTCTTTCTNCCCTTCCNTTCNTTTCTTTA
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66554064..66554197 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST14418H10BBF1
Sequence
TTAATTGTTACCTGATGTAAGAAGACCCAGTCCATTGTGGGTGTCACCATTCCCTAGGTCTAGCACCTTCTAAGAGAGGA
GAAAGCCAGAAGAAAGCAAGGAAAGATCACCCCCACCACCCAGTGTGGATGTGAAGCTTTAACTTCCCTGCAATAATGGA
CTGTCACCTGGAACTGTGAGTCAAAATACACTCTTCCTTCCTCAGTTGCTTTTTCTCAGGGTGCCCGTCACAGCCATAGA
AATGANNNNNNNACAAACAGTTGAAGAAAGCAGGAGAAAGTTTTTACCACTACGACTGCCAGATGATATCATTATGGCAA
AACAGAGATGAAAACATGTTAGTTATATAGAAGGAAATAGAGAACTCTCCATAATTCAATTGTGTATGAGAAGAACATAG
TTACCAAACATCTGGATTTACAAGAAGTTAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66554195..66554626 418
 
EST/CDNA Est Name
  AA797245.1 - BF302715.1 - CB236345.1 - BY708044.1 - BY705232.1 - BE374926.1 - BB851566.1 - AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427

 
Come back to gene AA797245.1 - BF302715.1 - CB236345.1 - BY708044.1 - BY705232.1 - BE374926.1 - BB851566.1 - AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427


For any suggestions or comments, please send an email to unitrap@crg.es