Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6159-NR
Clone ID PST6159-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6159-NR
Sequence
TGGTGAAGGGGAGGGTGGGCGAGGAGTGGCCCCTGAGCACCTGTTGCCCCCGTGGTAATAATGAACAGGGCAGAGACACC
CTCACTGTGAGCTGCGGGAGGAGATGCTCCTGGCAGAGGGAGATTGCTTCTGCAGCCCCAGTGGGTGCTCCCGCTATGCC
GTTTCCAGTGTGGCCAAAGCCAAGCAAGCCTCCCTGGGCACTACAGGCTCCCCTTGACCATGGAGAAC
Sequence Type genomic DNA
Unitrap ID UNI14843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25298573..25298794 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064264 (Zfp428) NM_146183 zinc finger protein 428 Gene [Source:MGI Symbol;Acc:MGI:1916463]

 
Come back to gene ENSMUSG00000064264


For any suggestions or comments, please send an email to unitrap@crg.es