Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0448
Clone ID AL0448
Vector pGT0lxr
Project sanger

Sequence tag AL0448
Sequence
ACAGGGAAGTTTGGTGAGCGGCCTCCACCCAAACGACTCACTAG
Sequence Type mRNA
Unitrap ID UNI2686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54018621..54018660 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 46480755..46480794 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079575 (AC158680.4) NP_001074396 SUH_MOUSE Isoform 2 of P31266 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:P31266-2]

 
Come back to gene ENSMUSG00000079575


For any suggestions or comments, please send an email to unitrap@crg.es