Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14751D6
Clone ID IST14751D6
Vector VICTR76
Project tigm

Sequence tag IST14751D6HMR1
Sequence
NCCTACCTTGGANCTGCCATACCCCCACTTTATAGACGAGGTCTCACTAAGTTGCCCAGGCTGAATTCATTCAGTTAGCC
TGGCCTTGGACTGTGCCCTTCTTTTTCAGCCTCTGAGGTATCTGGGATGTCAGGTCTGCTCCACCAAGCTCATCCTGGCA
CCAATTCTACGGTGGGAAAACACTGGAAAAACACACTTTGAAATCCAACCTGCTAATCTCTGGGCTTTTGATCTGAGGGC
TCTGAGTCTCCTCCTGCAAACAGGAACACAGGAAGGCTTGTCTGGCCTCTGAGAACAAGGAAAGGANGCTGTTCTGGACN
AANGACTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52919636..52919963 320
 
EST/CDNA Est Name
  AV057676.1 - BB848859.1 - BY236286.1 - BY782004.1 - BY788993.1 - BY789624.1 - BY780375.1 - BY142283.1 - BY236700.1 - BY234012.1 - AI662376.1


Sequence tag IST14751D6HMF1
Sequence
GGGTTAAGAAGAAGGACTTTAGTGTAGATATGAGAGAGAATAGCCAGAGAGTCCAGAGAGTCCAGGACAGGGAGGGAAAG
TAACATATTATAGAAAGGAAGAGAGGGTGTGGGGGCAGAGAGGAAGCCAGAGTGACAACCAAGGAGACTAAGAAAAAAAC
CAAAGGGGAATGTGATGAGCATAGAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI33348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52919439..52919637 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055978 (Fut2) NM_018876 fucosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:109374]


Sequence tag IST14751D6BBF1
Sequence
GGGTTAAGAAGAAGGACTTTAGTGTAGATATGAGAGAGAATAGCCAGAGAGTCCAGAGAGTCCAGGACAGGGAGGGAAAG
TAACATATTATAGAAAGGAAGAGAGGGTGTGGGGGCAGAGAGGAAGCCAGAGTGACAACCAAGGAGACTAAGAAAAAAAC
CAAAGGGGAATGTGATGAGCATAGAAAAAAAAAAAAAANNTNNTT
Sequence Type genomic DNA
Unitrap ID UNI33348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52919440..52919637 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055978 (Fut2) NM_018876 fucosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:109374]

 
Come back to gene ENSMUSG00000055978


For any suggestions or comments, please send an email to unitrap@crg.es