Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10255F7
Clone ID IST10255F7
Vector VICTR76
Project tigm

Sequence tag IST10255F7BBF1
Sequence
NTGTTGCANCACCGGCGCGTGCACANNGGCGAACGGCCCTTCTNCTGTGCCNAGTGCGGCCAAAGCTTCCGGCANCGCTN
TAATNNNNNNCNGNACCANCGCATCCACACTGGAGAGCGGCCCTTNNNCTGNNCCNAATGTGGNAAGACCTTCCGCCANC
GGCCCANNCTNACNCANNANCTGNNTGTGCNTACNGGTGANAANCCCTTNNCGTGCCCNNAGTGCGGNCNNNGCTTCNNN
CANCGACTCANNCTNANNCNCNNNNNANNGACCCATACTGGCGANNAGNNNNACTGCTGNNGNGAGTGCNNNNTNNGCTT
CACGCANGTGTCTNNGCTNANCGAGCACNNNNGCATNCACACANGNGANCGGNNNTTNGNNNGNNNCGAATGTNGCCAGA
GTTTCNNGCANNNCNCCNANCTNACCCANCNNNCGGCGCATCCATACNGGCNANCGANCCTACGCGTGTCCCGNATGTGG
CAANGNCTTTCGCCAGCGGCCCNNGCTCANNCANCANCTGNGCACTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10255F7HMF1
Sequence
CTGTTGCAGCACCGGCGCGTGCACAGCGGCGAACGGCCCTTCGCCTGTGCCGAGTGCGGCCAAAGCTTCCGGCAGCGCTC
TAATCTNACCCAGCACCAGCGCATCCACACTGGAGAGCGGCCCTTCGCCTGCGCCGAATGTGGCAAGACCTTCCGCCAGC
GGCCCACGCTCACGCANCACCTGCGTGTGCATACGGGTGAGAAGCCCTTCGCGTGCCCCGAGTGCGGCCAGCGCTTCANC
CAGCGACTCAAGCTCACGCGCCACNNAAGGACCCATACTGGCGANAAGCCCTACTGCTGCGGTGAGTGCGGCCTCGGCTT
CACGCANGTGTCTCGGCTCACCGAGCACCAGCGCATCCACACAGGTGAGCGGCCCTTCGCNTGTNNNNAATGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13628846..13629240 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030380 (Mzf1) NM_145819 myeloid zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:107457]

 
Come back to gene ENSMUSG00000030380


For any suggestions or comments, please send an email to unitrap@crg.es