Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6405-NR
Clone ID PST6405-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6405-NR
Sequence
TAATTTCTAGAGCATACCCTGCAGCAAGGCTGTGGTGTTTGCTCGAAACATCCTCAGACAGCATG
Sequence Type genomic DNA
Unitrap ID UNI15319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59261394..59261457 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009894 (1110031B06Rik) NM_144521 RIKEN cDNA 1110031B06 gene Gene [Source:MGI Symbol;Acc:MGI:1915076]

 
Come back to gene ENSMUSG00000009894


For any suggestions or comments, please send an email to unitrap@crg.es