Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15079C4
Clone ID IST15079C4
Vector VICTR80
Project tigm

Sequence tag IST15079C4BBF1
Sequence
AAGTAAATGGAAGGTTTTCAGGAGGTTGGGGGTGGAAGCTCGGCATGCCTAGAGGAGTGACTGAAAAAGAGCATGGAAGG
GCAGAGGGCACCGGGGACAGAGCACTGCCTGTCAAGACCAAGGCAGGAATTTGGGAAGTGGAAAATACACAGTGCACGCA
GCCCAAAGAACAAAGCCCACGCCCGGGGTCCTGGAAGCACCTCACTGGAAGACTATGCGATGAGCCATCCGGATAGAAGG
GGAGCAGCCATGGGGAGCAGCCGAGGTTCCAGGAATAGGGCAGGGGACACCAAGATGAGATGACGAGGCCCCACAGCATT
CTGAGGGCGTCCAAAAGCAGGTGCTGACTCACAGTCNAGCTGAGCTGACGTATCAGTCCACACCTCAGTGGGGACCAACT
TGTCCTGCATCCCTAAAAATACCTTCAAGGGGAGGTCACTGCTACCGGAAAGCTCAAATGANGCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169209101..169209564 460
 
EST/CDNA Est Name
  BB657773.1 - BG077442.2 - CX229581.1 - CA466639.1 - CX240707.1 - CX219622.1 - AA764207.1 - CJ069243.1 - BY729271.1 - BB665446.1 - CN665774.1 - BY728872.1 - CA466474.1 - BQ886581.1 - BQ958439.1 - BQ964425.1 - BB618812.1 - CB587587.1 - BY738653.1 - CB520180


Sequence tag IST15079C4HMR1
Sequence
NNACNTNNNTGCTCCACTGCANTGTGGAGGGAAGCCCCCTGCAGCAGCAAGCCTCCTGCANCANCGCANCCCTGTTGCCT
TTCCTCATGGAGGCCCTTCCTTTATTCTTAGGATGAGTGTCTTTTCTGATGCTCACCCCCTGTGGTCACCTCAGTCCATC
TTAGTGAACTGTGTGGTCTCCAACTTACTGTAATTTTTTTTGTAAAATATTGCTTTATACTTTATTTATTGCGTGTCAGT
ANCCTACACATGTTCANACCTGGTGGAAGGAGACGGTGGACTCTCACTCTCTCTCAAAGTCTGGCTTTTATTANCTCCTG
TGGTGCANACAGCTTGCATTTGGGAGTGCCACTGAAAATGCTGAGATAGGACTTTTTGCTGGTGGGCTCTGTGACGGTGA
TCATGAAACTTCAAGGTCTTTTANGTCTTTCAAATTCATTTATTTGGCTTTTTGCNACAGGGTTTCTCTGTCNTTTAATA
GTCCTANCTGTCCTGGAACTCTCCCTATNNATCN
Sequence Type genomic DNA
Unitrap ID UNI13682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169208594..169209097 472
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026558 (AC142244.11) NM_030724 Uridine-cytidine kinase 2 (UCK 2)(EC 2.7.1.48)(Uridine monophosphokinase 2)(Cytidine monophosphokinase 2) [Source:UniProtKB/Swiss-Prot;Acc:Q99PM9]

 
Come back to gene ENSMUSG00000026558


For any suggestions or comments, please send an email to unitrap@crg.es