Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST0019-NR
Clone ID PST0019-NR
Vector U3NeoSV1
Project escells

Sequence tag PST0019-NR
Sequence
ATACAAACCATCTCAACACCTATGACTAGATGTGCCCCTGGCACCCCACAGTCACTTAGAAGTTTGGCTTAGGTTGGAAA
GAANAGGTGGGCCTTGCCAATGCCCCCCGAAACCCGGGCCGAAAGGAAATCCTTCCGTTTCCGGTTTGGAACCCCCCAAT
TGGGGCCGGAATTGCCCCCTGGCCTTTGGGCCCCGAAATTATTTCCAAAA
Sequence Type genomic DNA
Unitrap ID UNI14809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73112764..73112826 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es