Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12827E5
Clone ID IST12827E5
Vector VICTR76
Project tigm

Sequence tag IST12827E5BBF1
Sequence
GGTTAAATTACTTATTCACAGTTAATCTCCAGTTCAGTGAGCCTGGATTCCACATGGGTCTGTTGACACTGGAGCCCACT
CTTTTGACTACTGCTCTGAGCTTCTGGTATGATTTGAAAAGAGGTC
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112337532..112337656 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]


Sequence tag IST12827E5HMF1
Sequence
GGTTAAATTACTTATTCACAGTTAATCTCCAGTTCAGTGAGCCTGGATTCCACATGGGTCTGTTA
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112337532..112337595 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es