Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11570F12
Clone ID IST11570F12
Vector VICTR76
Project tigm

Sequence tag IST11570F12HMR1
Sequence
CNNTCCTCTATAAGTGGCNNNNAGTACCTCCTGTCATTAACCAGTTTACTCAGGCCCTGGACAGGCAAACAGCTACTCAG
CTTAAGCTTGCCCACAAGTACAGGCCAGAGAAGAAACAAAGGCTACTGGCCCATGCTGAGAAGAAAGCTGCTGGCAAAGG
GGACGTCTCAACTAAGAGACCACCTGACTTCCAATCAGGAGTCAATACAGTGATTGTCCATGACGTANACCCATTGAGCT
GGTGGTTTTCCTGTCTGCCCTGCGTTGAAAGATAGGGGTGCCCTGCCCTACAGCATCATCAACGGAAGGGCCNGTCTGGG
GTGCCTGGTCCACAGGAAGACATGCACCACTGTGGCCTTCNCACANGTTN
Sequence Type genomic DNA
Unitrap ID UNI3327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73080002..73080367 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]


Sequence tag IST11570F12HMF1
Sequence
TTGGTTCTTTGCCNCTGTGACCTGATGTAGTGGGGCCATTTGACNAAGCGTGTTAGATTTCTTTTGGGCTGGATGTCCTG
CCCAATGCCAAAGTTCTTGGGCCTTTTCTCAAAGGATTGACCACCTTTTTAGCCTCCTGTTTCTTGACGATGGCGGGGTC
CGGGGCCACTTTCTTCCCCTTGGGCATCTTGCTTGGTTGATGGANAGAACTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73079782..73080001 214
NO GENE  

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es