Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0352
Clone ID AL0352
Vector pGT0lxr
Project sanger

Sequence tag AL0352
Sequence
GCTACTATCTCGTCTCTTCCTAGGGGGTTCCTCCCTACCTTCCCTTTTTTCTCTCGTCCTCGATATTGGCCTGATTCTCC
CGTTCTCCATAGTAACCGTACATCACTGCTCAGTATCGCTCCAGTCCCGTCATTCGTACCCCTGGCCCCGTCGGTCCTAT
CCCTTGATGTCGGGGACTTCCTGGATGAGGTTCTGTTCATTGAGCTCCAGCGGGAGGAGGCAGACAAGCTG
Sequence Type mRNA
Unitrap ID UNI2691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26511151..26511217 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es