Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13171A1
Clone ID IST13171A1
Vector VICTR74
Project tigm

Sequence tag IST13171A1BBF1
Sequence
AATTCAGTGCTCTGCTCCTTGCTTGAGGCGCCCGCTGCATATCTCCCTGTTGGCCTGACTCAGTCAGCCCTGGGGGCGCG
GTTCCCACCTCTCTGCATGGCCTGACTGGAGCATCGAGGCTGGAGCACCGGAAACTACTTGGTTTGGCAACTCTGACGGG
ACTAGGGAGGAGTTGCANAGCTACTGGAGGTACCTATGGAACGGGAAGGCCCAGGTGTCTAGGTGGTACCTGGGAGAGCT
GGAGGTACAGACCCCTGGATGGGTGATCTCACTGACGGACAGCTTCCTCTGGGCAAGCTTTCTTTTGCTCCAGGATGGCC
CAGTGTGGTCNACCGATAAATCCGACTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI5423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73901566..73901918 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017756 (Slc12a7) NM_011390 solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]


Sequence tag IST13171A1HMF1
Sequence
CTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAAATATCTTGTATTTGGACCTCCTCCTGACCGAANAAAAAGGCCCAA
AACAGGACCTTTCTCAGACAGTGTGTTGCTTTGGCAGTTCCCAGGTGGTACANACTCTCACCTAAGCAGACTAAATTCCT
AAGTTCCTTGGAGTCCCGGGACCAANATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCGGGTGGGCACCT
GTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCANCCCACACAGGGTGCTGCCTCANCGCCTCNGTGCTTCTGCCTGTTC
CAAAANCTGTCANGTTCTCTGGCGCACCCTCTCACCNGTTCAGACTAATTTCCNAANTTCGGCGGGTCCCGGANCNANAN
GGNGANNNCTGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017756


For any suggestions or comments, please send an email to unitrap@crg.es