Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0422
Clone ID GC0422
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0422
Sequence
CTCCACTGACATGCACTTCATAGAGGGAGTACTTGGGAGAGGAGAGCATGCGCATGTCAGGGCGGAACTTCTCTGCCAGT
GTTTCAATCACATCTTGAGTGGTGGCTGTGCTAGAGACTCGAATACATTTTGTTGCAAAGTTTCCAGCAGCTTTATCTTG
AAAATAAAATCTCATGACTCCATGAAACTCCAAATCCTCGGTCGGCTGGCTGATCTCGAACAGGTCCAGCCGGTTGGCGT
TCCAGTGGTGAATGATGTCGGCCAGCTTCCGCCGCTTTTATCCGCGCCCCCC
Sequence Type mRNA
Unitrap ID UNI262

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13897690..13941141 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]

 
Come back to gene ENSMUSG00000068036


For any suggestions or comments, please send an email to unitrap@crg.es