Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13035D2
Clone ID IST13035D2
Vector VICTR76
Project tigm

Sequence tag IST13035D2HMR1
Sequence
NATTTGTACNNAAGTCTGAAAGGGAAAGGCTCTTTCCAGCCNATATTATAAAGCAGGAGCTGTGGGCCNGAAGCGAGAGA
CATGGCATTCATCCACCAGTTTTGTTTTTAAGCTTCCAAACTTGGTTAGTTGGGGGAAAGGACTGCCTTACATATTCCCT
GTGTGTTGGTGCTTTGTTGTAAGGCTGTAGCTGCTGGTAAATAAATCAGTTGTTCAAAGTGTGTTTTATTTTTGTTTTGT
AGTCTCCTCTAAGCCATGACCTCATCCTTAACCTGACTCAGGACGGGATCACACTACTGTTTGATGCTTTCAACCAGAGA
CTCAAGGTAACCATACATGACAACTATAGTTTCATACCTGGTTAGTCCAGTCTGTCTGGAGCTGATTAACATGTGCTATT
GTGAGGTGTTTTGGANACNTATAAGTGGGTGTANACTTGATTGGTTNNNTANAAAAA
Sequence Type genomic DNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107758141..107758595 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es