Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12555A10
Clone ID IST12555A10
Vector VICTR76
Project tigm

Sequence tag IST12555A10BBF1
Sequence
ATAGCATATTATCAAAAACCCAGTCATTGAGCTGCAGCTTTCACACCACTATCTCAAGGGCCTTTTCATAGTTTTGTGTG
TACCAATATTAAATCTCATGTCTTTTAAAAAACATCAATATTTCTTTGTTTGAGACAGGATCTCATCATGTANACTAGGC
AGGCTTTAAGACTTTTCTGTGAAGTCCATGTTCGCCTCAAACTCATAAATCTTCCTATCAAAAATTAATATTTCATAGAT
AGAATTTTAACTTTTTCTTGTTCTGTTGTTTTGTTGAGGCANGGTCTCACTGTGTNNCTCTGGCTGTTTTANAACTCACT
ATGTANNTCANGCTGGCCTTGAACTCAAANANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI35075

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34107409..34107765 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038718 (Pbx3) NM_016768 pre B-cell leukemia transcription factor 3 Gene [Source:MGI (curated);Acc:Pbx3-001]


Sequence tag IST12555A10HMF1
Sequence
ATAGCATATTATCAAAAACCCAGTCATTGAGCTGCAGCTTTCACACCACTATCTCAAGGGCCTTTTCATAGTTTTGTGTG
TACCAATATTAAATCTCATGTCTTTTAAAAAACATCAATATTTCTTTGTTTGAGACAGGATCTCATCATGTANACTAGGC
AGGCTTTAAGACTTTTCTGTGAANTCCATGTTCGCCTCAAACTCATAAATCTTCCTATCAAAAATTAATATTTCATANAT
AGAATTTTAACTTTTTCTTGTNCNGTTGTTTTGTTGAGGCANGGTCNCACTGTGTANCTCNNNCN
Sequence Type genomic DNA
Unitrap ID UNI35075

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34107466..34107765 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038718 (Pbx3) NM_016768 pre B-cell leukemia transcription factor 3 Gene [Source:MGI (curated);Acc:Pbx3-001]

 
Come back to gene ENSMUSG00000038718


For any suggestions or comments, please send an email to unitrap@crg.es