Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11717A11
Clone ID IST11717A11
Vector VICTR76
Project tigm

Sequence tag IST11717A11HMF1
Sequence
CTCTTACCCACTGAGCCATCTCACCAGCCCCTTT
Sequence Type genomic DNA
Unitrap ID UNI31282 UNI35076 UNI35077 UNI35078 UNI35079 UNI35080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4430974..4431007 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24074350..24074383 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21562712..21562745 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023882 (Zfp54) NM_011760 zinc finger protein 54 Gene [Source:MGI Symbol;Acc:MGI:99201]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15659372..15659405 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022672 (Prkdc) NM_011159 protein kinase, DNA activated, catalytic polypeptide Gene [Source:MGI Symbol;Acc:MGI:104779]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12119328..12119361 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9403748..9403781 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9791661..9791694 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22434193..22434226 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22075653..22075686 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48020553..48020586 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037544 (Dlgap5) NM_144553 discs, large (Drosophila) homolog-associated protein 5 Gene [Source:MGI Symbol;Acc:MGI:2183453]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25068093..25068126 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11654723..11654756 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22348138..22348171 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4663158..4663191 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34708590..34708623 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11182592..11182625 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41452068..41452101 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059834 (Sclt1) NM_001081411 sodium channel and clathrin linker 1 Gene [Source:MGI Symbol;Acc:MGI:1914411]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 93147081..93147114 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29931937..29931970 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 37539130..37539163 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026110 (Mgat4a) NM_173870 mannoside acetylglucosaminyltransferase 4, isoenzyme A Gene [Source:MGI Symbol;Acc:MGI:2662992]

 
Come back to gene ENSMUSG00000026110


For any suggestions or comments, please send an email to unitrap@crg.es