Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10677G10
Clone ID IST10677G10
Vector VICTR76
Project tigm

Sequence tag IST10677G10HMF1
Sequence
GAANAAGATANAAAGCTTTGTAGCTGTGCTTCTCTTACAAACGCTGANATCNNAAATGAGGAATATCAGTCAGCTCTGGG
CCTCCAGAGCGGGGCTTCTTGAGCTGTGGGCATATTGATTTACTCATCTGTGCCGTTTCCCACACACTGCCTTGTCCACA
CTCTGCTCATCAGACTGGAGCAATCAAGCCCTGTGGGTAAGTGCTGGAGCTCGCTCTCCCTCGCCGTCCCTCTCACAGTG
CTGGGAACCAGGTANCANCCTTTGTGGATTCCAGGCAAAAGTTGCTCTGTGGAGGACTGGCCTGAGCTTCTGACCCGTCT
TTCCCAGGTGATCGTGGAAAAAGTCTCGGGCTCTCANATTGTTA
Sequence Type genomic DNA
Unitrap ID UNI19271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466075..114466437 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST10677G10BBF1
Sequence
GAANAAGATAGAAAGCTTTGTAGCTGTGCTTCTCTTACAAACGCTGANATCNNAAATGAGGAATATCAGTCAGCTCTGGG
CCTCCAGAGCGGGGCTTCTTGAGCTGTGGGCATATTGATTTACTCATCTGTGCCGTTTCCCACACACTGCCTTGTCCACA
CTCTGCTCATCAGACTGGAGCAATCAAGCCCTGTGGGTAAGTGCTGGAGCTCGCTCTCCCTCGCCGTCCCTCTCACAGTG
CTGGGAACCAGGTANCANCCTTTGTGGATTCCAGGCAAAAGTTGCTCTGTGGAGGANTGGCCTGAGCTTCTGACCCGTCT
TTCCCAGGTGATCGTGGAAAAAGTCTCGGGCTCTCANANTGTTGACATAGACNAGANGAAGTACTTGGTCCCCTCGGNCA
TCACTGTGGCTNANTTNATGTGGATCATCANGAAAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466075..114466515 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es