Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13937B4
Clone ID IST13937B4
Vector VICTR74
Project tigm

Sequence tag IST13937B4BBF1
Sequence
CTAATAATTCACGATAACTGTGAGTAGCAGGATCACATAGGGAGATTANAGACTCAAGTGGTGGCACGTTACGTGCATGT
ATGTTTTTGTTTGGTTTN
Sequence Type genomic DNA
Unitrap ID UNI33273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23899755..23899851 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028973 (Abcb8) NM_029020 ATP-binding cassette, sub-family B (MDR/TAP), member 8 Gene [Source:MGI (curated);Acc:Abcb8-001]

 
Come back to gene ENSMUSG00000028973


For any suggestions or comments, please send an email to unitrap@crg.es