Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10056G9
Clone ID IST10056G9
Vector VICTR75
Project tigm

Sequence tag IST10056G9HMF3
Sequence
GGAATAAGGGGAGTGGGACTGAGCTTTAGATAGGAATCTCGGGCACGTCTCGGGACCATGGCAGGCGACGCGGGATGGAG
TGTACGAAGGGGGAGACTACACAAAGGAAGGCCGTGGGCCTCAGGATTTCCCTTTTCCTACCTGTAGGCGCCGCAGCAAA
TGGGATCAGCCAGCGCCAGCTCCGCTTCTCTTCCTGCCGCCAACGGCCCCAGGTGGAGAAGTCGCTGGCAGCGGGGCGAG
CCCCGGGGGCGCCACCACCGCCGCCGCTCCTTCAGGAGCCTTGGATGCCGCCGCTGCCGTGGCTGCCAAGATCAATGCTA
TGCTCATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI2992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88490119..88490450 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]


Sequence tag IST10056G9BBF2
Sequence
GGAATAAGGGGAGTGGGACTGAGCTTTACATAGGAATCTCGGGCACGTCTCGGGACCATGGCAGGCGACGCGGGATGGAG
TGTACGAAGGGGGAGACTACACAAAGGAAGGCCGTGGGCCTCAGGATTTCCCTTTTCCTACCTGTAGGCGCCGCAGCAAA
TGGGATCAGCCCTAGCCAGCTCCGCTTCTCTTCCTGCCGCCTACGGCCCCAGGTGGAGAAGTCGCTGGCAGCGGGGCGAG
CCCAGGGGGCGCCACCTCCGCCGCCGCTCCTTCAGA
Sequence Type genomic DNA
Unitrap ID UNI2992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88490119..88490393 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es