Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14086E6
Clone ID IST14086E6
Vector VICTR74
Project tigm

Sequence tag IST14086E6BBF1
Sequence
CTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTN
Sequence Type genomic DNA
Unitrap ID UNI14535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7304879..7304942 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3021358..3021421 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484897..47484960 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 111759927..111759990 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 113536039..113536102 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 38119696..38119759 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10102235..10102298 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 122749742..122749805 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52406911..52406974 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 112925664..112925727 64
NO GENE  


Sequence tag IST14086E6HMF2
Sequence
CTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTA
Sequence Type genomic DNA
Unitrap ID UNI14535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7304876..7304942 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3021358..3021424 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484897..47484963 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 111759927..111759993 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 113536039..113536105 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 38119696..38119762 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 122749742..122749808 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52406911..52406977 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 112925661..112925727 67
NO GENE  

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es