Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0245
Clone ID AL0245
Vector pGT0lxr
Project sanger

Sequence tag AL0245
Sequence
GCCTCTCCTCTGTAATCTCCTTCCGTCCATTCTCTCGGATTCATTTCACCCTATTTTATTTCTCGATTTCTCATCTTGTT
ATACCGAGCTTCTCTCTCCTCTTTTTTCCTATGAAGTCCAGCATGCCCCATTAGATCTTACCCAGGGTTCTCAGGCTGCT
CCCAGCAAACTGGAAGGAGAGATTTCTCGGGTCAGCATCACTGGCTCAGCTGATGTCAAAGCCACAGCGATGTCCATGCC
GGTTACACAGGCCAGTACCTCTTCTCCCCCATGTAATTCTACGCCGCCAATGGTGGAGAGGAGGAAGCGCAAGGCCTGTG
GGGTCTGTGAGCCGTGCCAGCAGAAGGCCAACTGTGGGGAGTGCACCTACTGCAAGAATCGAAAGAACAGCCACCAGATC
TGTAAGAAGAGGAAATGCGAGGTGCTCAAAAAGAAGCCAGAGGCCACCTCACAGGCACAGGTTACAAAAGAAAACAAGAG
GCCCCAGAGGGAAAAGAAGCCCAAAGTTTTAAAG
Sequence Type mRNA
Unitrap ID UNI350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62327556..62341249 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075009 (Tet1) tet oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:1098693]

 
Come back to gene ENSMUSG00000075009


For any suggestions or comments, please send an email to unitrap@crg.es