Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12041E10
Clone ID IST12041E10
Vector VICTR76
Project tigm

Sequence tag IST12041E10HMF2
Sequence
AAAGTTCCTTANAGTGACCTCTANTAATACTGACCTCTGTCCTTGGAACCATANGGTTAGGAGAAGGGTTAAATATTGCT
TANGTCTCCTGAAGAAAAGGAATTTTANCAACACACAGGCACACAAAGGAGGAATATTGTGGAAGACATTTCTGGGCTCA
ACCTCTCTTTCCCATGACCACTGCCTCCCTGCACTTTGGGACCATTATTANCAATTTCCACAAGGAAGTGCANCAGCCTC
CTGGAGAAAGGGCACCTGANACACAGGTATCTGCCATGGTGCCAAGCTTTCTCACCTCTAACTTATTTNAGTTCTGTTCA
GTTCCTCTCCCCTCTGCCCATACCTTTTCCTCCACCTCCAATACTAGGTGCTCGTGACTCTGTTTCCNGGGAACCCAAGA
CCTCAAGGAAGCATTCAGGGACAGTAAGTCTCTTGNNCCAAGCAGAAAGTCACACATAGCCCANCGTNTTGTATCTTTAC
AATTGTTCNGTGGTGGTNAGTTAAGTGGTCGCTTTGTAATGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI32244

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 17410068..17410593 494
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017491 (Rarb) NM_011243 retinoic acid receptor, beta Gene [Source:MGI Symbol;Acc:MGI:97857]


Sequence tag IST12041E10BBF1
Sequence
ATAATGGAGCCTCATTTGGAAAACCATAAGTATATACATTAATCATTTATTGATTAGGGCAGTGCTCAGTGTTCTGCCTT
GTCTTATTTTCATTAGGCAAGCACACCTACATTGTCTACAGTTTCTGGTTTTCTTTAATTCTAACTGGAATGACAGCTTA
AGATACTTCCAAAATATTCTGAGTACAGAATCACTAGATAAGACTTTCGAATTTTGTTCCCTGGCTTTTACTGTGGTCTT
GGCCTTATCAAGCCATTCAATGGCAATTTTCAGGGTCATAAAACTATATCTTACCNATTTAGTTTAAAATAACTCTCTTG
GGCTGGANAGATAGCTCAGTGGTTAAGAGCACCAACTGCTCTTCCAAAGGTCCTGAGTTCAAATCCNANCNNCCNCATGG
TGGCTCACANCNNTCCGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90907603..90908031 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es