Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14968E7
Clone ID IST14968E7
Vector VICTR76
Project tigm

Sequence tag IST14968E7HMF1
Sequence
GCTGCAGACGTGTATATATTAGTTGAGAAAGAAACAAGCAGCCAGCACTGCTGTGTGCCTACAGGAAGAAACAATAGTGA
AGGAAATCGCAGCCCCTGCCTCTCAGCAATGACAGAGCAACCAGCTCATTAAAAGATTCAGCTGCAAGAGACATAATGGG
TGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135201560..135201722 163
NO GENE  


Sequence tag IST14968E7BBF1
Sequence
GCTGCAGACGTGTATATATTAGTTGAGAAAGAAACAAGCAGCCAGCACTGCTGTGTGCCTACAGGAAGAAACAATAGTGA
AGGAAATCGCAGCCCCTGCCTCTCAGCAATGACAGAGCAACCAGCTCATTAAAAGATTCAGCTGCAAGAGACATAATGGG
TGGCCACGTAGTCTGAAGATACTAGGTTTCAGAAATGGGTCTGTCTCTGGGTGTTAATANACCTGTCTTTTGTTATATTC
CCTTGTTGTAGGATTAACACATTAAAGATAATCAACTATAAAAATTGTTGGCNCCNNANANTAANANNTTTTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135201409..135201722 294
NO GENE  


Sequence tag IST14968E7HMR1
Sequence
CAGCCNGTGTAGCATGTCCACCCTGTAAAAACTTTGATGCAGTCTTGGTTTTTGGTTGGTAAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI3618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135201719..135201785 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es