Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3988-NR
Clone ID PST3988-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3988-NR
Sequence
GTGTTGGCCTGGGGATCAGACTCAGGTCTCACTGGTTTTGTTTTCACATAGGAACGGTTTATAACTGGCTTATCAGTCTT
TACCTTCTCTTGTCCATCCAGAGGTCGGATGCCTAAAATCCCAACCTCCTAACAACCTGAGTTACCCCTCTGGTGACCAG
GCTCAATACCTAGAGACTTTTCTCTTTCTTTTAAGATTTGTTATTTTATATGTATGGGGTATGTGTGCAACCAGATGTGG
TATTTTATATTCATGGGACCTGAGTGTG
Sequence Type genomic DNA
Unitrap ID UNI14888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30698361..30698625 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]

 
Come back to gene ENSMUSG00000058402


For any suggestions or comments, please send an email to unitrap@crg.es