Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14557C6
Clone ID IST14557C6
Vector VICTR74
Project tigm

Sequence tag IST14557C6HMF1
Sequence
GTATGATCACAATATGCCCACTACTTGCTACTGTTTTTGTGGTAATAGTGGAGCATAGTGGCATCTTANAAGTCATGTGA
AAAACAAGCACAGAAACCAAAGCTCAGCCATGGTGGGAGAGCACAGAAAGACAAGAGCTGCGACAAGAAAGACAAAAAGG
AAATGATGAGTGCAATTCAGCAATGATTTGCATTTCGCTTCAGCCAAAGAAAATCCAGCTATATTTTTCTGGGTTCCAGC
ATTTCAGTGACAGCTGCATTCATGAATGACCAAATTAACTATTGTGGAGCTTTCTAAAAATATACAAAGCACTCACTCNA
CCGTATGCTATAAGCAGGTCATGAAATATCAGGGGGGGAAAAAAAAANCNNCCANCAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70892379..70892758 368
 
EST/CDNA Est Name
  CJ103272.1 - BI107336.1 - BB864526.1 - AW012173.1 - AW012153.1 - CJ179179.1 - BF451606.1 - AW209852.1 - CD564179.1 - BB861315.1 - CJ102752.1 - CJ102177.1 - BB861619.1 - BY245820.1 - CJ101811.1 - CJ101566.1 - CJ100903.1 - CJ100298.1 - BQ887227.1 - BI714271


Sequence tag IST14557C6HMR1
Sequence
ATACCTTCCGCGCATTCACTTTAACATATTAAGTCCCAACAACTGGATGCAGACCACCCATTCAGACATGAGGGCCATGC
CCCTCACTTGCTGCTCTACTGTAATGGCGCTGTCTTTCTTGGTTTGGACCAAAGTCCCCCCAGTTTCTCCCAGGTCTGAA
TGCTTAACCTCTGGAAACTCTGTGCGCTTGAGAAGACTGTTTACTTGCTTCTCCTTCACGTCCACTCTTACCAGGGTGGT
ACTTCAAGGCCNNTTGCCTCTCAGTGTTTTTCANGTTTTTCCNCGAGGCATCAAGCTTGGCCCCTAN
Sequence Type genomic DNA
Unitrap ID UNI35094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70892077..70892382 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041975 (Mettl8) NP_663499 methyltransferase like 8 Gene [Source:MGI (curated);Acc:Mettl8-002]

 
Come back to gene ENSMUSG00000041975


For any suggestions or comments, please send an email to unitrap@crg.es