Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12763D7
Clone ID IST12763D7
Vector VICTR76
Project tigm

Sequence tag IST12763D7HMF1
Sequence
CACCCAACTGCTCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCT
GGCTCCCTCTTCTGGACTGTCANAANACAGCTACAGTGTACTTACATATAATAAATAAATAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114489749..114489897 145
NO GENE  


Sequence tag IST12763D7BBF1
Sequence
CACCCAACTGCTCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCT
GT
Sequence Type genomic DNA
Unitrap ID UNI31391 UNI35095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71045571..71045651 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55927209..55927289 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022604 (Lrriq2) NM_028815 centrosomal protein 97 Gene [Source:MGI (curated);Acc:Lrriq2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114489749..114489829 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 134626787..134626867 81
NO GENE  

 
Come back to gene ENSMUSG00000022604


For any suggestions or comments, please send an email to unitrap@crg.es