Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10926C4
Clone ID IST10926C4
Vector VICTR76
Project tigm

Sequence tag IST10926C4HMF1
Sequence
GGCTGCACTAAGGGGAATCCCGGTTTCTAAACAGCATGATCTCCCAGGATCCTGACTGAGCTTGGCTACAATCTTCTAAG
ATGTGAGTGGGTTCCCATTCGCAACCAAGAAAGCCCGCTTACTCTCTTCCTCACTCCCTTTTATTTATTTATTTATTTAT
TTATTTATTTATTTATTTATTTATTTATTTATGAGAAAGCTCACCCCATGAGTCAGCTCCCGGATGCAAAGGCAGTACTA
CTGCTGTCAGCAGCCTGGACAGCTTGCAGACAGCCGCCCCAGCAGCTGGGCGGGGCACTCCCGCCCGCCCTCCGGANCCA
GCTGGTTCTTACCNGCTTTGGCTGCTTTTGAAGCACGTCTTGTGGCTTCCCGCAGCTTTTCCATCTGANCTCCGGGGAAA
GGAAGAGTTCTTTTGCTTGAGACAAAGATTGACGGTTCACACTTGGACATAGCTNATCTTTGGGCTCCCGTTTTTTTGAA
ACTAATTN
Sequence Type genomic DNA
Unitrap ID UNI16411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43213888..43214378 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]


Sequence tag IST10926C4BBF1
Sequence
GGCTGCACTAAGGGGAATCCCGGTTTCTAAACAGCATGATCTCCCAGGATCT

Sequence Type genomic DNA
Unitrap ID UNI16411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43213888..43213938 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 61089129..61089179 51
NO GENE  

 
Come back to gene ENSMUSG00000023915


For any suggestions or comments, please send an email to unitrap@crg.es