Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14308A4
Clone ID IST14308A4
Vector VICTR74
Project tigm

Sequence tag IST14308A4BBF1
Sequence
NTANCNGNNNNNAACNCNNNCTCTCNCNNCTGAACTTGGCTGANAAACACATTGCACAGGACCNNTTNACATACTTTTGG
GGATGCTTANGGGTCTANCACTCATAAGAGTGTGTATCAAACATTCTAANCAAGGCACAGAANAGCGGACATCACAGGCA
TCTCAGGTAACACTGCACGGCCATGACATGCCTTGCCACCCAGAAAACTCCAGGAGAATTGGGCAGAACCCTGACGAAGG
CACCCTGACTTCAGAGACACACCACCTCCAAAGTGGGCTTCAAGTGTATCATTTCTTGTGACTTGAGAGAAAACAAGAGA
CCAGATAAAAAATAATGCAGCANCGGGGCATGGTGGCGCACGCCTTTNATCCNNNCACTCNCGANGCAGANGCANGCGGN
TTTCTGAGTTCNAGGCNNGCCTGGTCTACANANTGAGGTCCNNGATANCCANGGCTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14308A4HMR1
Sequence
ATTANAGGCAGGCTGTGCCCTGCTGCTCCTTTTCCCAGGAAGTGTAAATTAACTGTGGCAGGAGGAGGTCNAAACAGCCA
TCAGGACCCAAACTGTAGCTAGGGCGGCTGCCAGTGCAGCCAGGTTGCTTCCTACAGTAAAGTTACCTAAAGCTGTGTAG
TANAAGGCTTAAATCTACAGGCTTTAATTATAATTTTANAAGTCTCCCAAATCACTCTTGCTCCAAAGGTTCAAGTTGAG
GATTCTTCCTTGCTTCTGGCTTCTGATANTGGCCTGTANTCCNTGGTATTTCCTGGCTTCTANAAGGATGCNNNCCANAT
GGCATCCCTGTCTTCACATGTGCTCCCNCN
Sequence Type genomic DNA
Unitrap ID UNI18303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123339018..123339364 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es