Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12897B7
Clone ID IST12897B7
Vector VICTR76
Project tigm

Sequence tag IST12897B7BBF1
Sequence
AATGAGAGAGAACTTATTCAAGTTATTTTGCAGGAATAAAGAATCTCTTTTCGTTGATGCTATGCTTATCCCATGTTCAC
TAATTTGCTTAAGAAAAAAATTGTTTATAGTAAGGATGGGCTTCTGCAGAAGACCATTGGCTTGCATAGAGTTACTCTAC
TCAGGATTAGTAAGGCATTTTACATAGCCTCTCATAAGACTTCAACGGACTGGGTATTTAAAATAATTGCCTATTGAGAG
TTTTTANATAGCAAGCTTTTGGGAACACATACAATAATAGTTATTTTCTCATGGATTCTTAGGGGGAGAAATATTTAATA
GTTGGCTTTAAGGCTCANAGGATAGGCCNGGCANTGGTGGTGCATGCCTTTAATCCCAGCACTTGGGANGCNGAGTCNAG
CNGATTTCTGAGTTCN
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90911812..90912226 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]


Sequence tag IST12897B7HMF1
Sequence
AATGAGAGAGAACTTATTCAAGTTATTTTGCAGGAATAAAGAATCTCTTTTCGTTGATGCTATGCTTATCCCATGTTCAC
TAATTTGCTTAANAAAAAAATTGTTTATAGTAAGGATGGGCTTCTGCANAANACCATTGGCTTGCATAGAGTTACTCTAC
TCAGGATTAGTAAGGCATTTTACATAGCCTCTCATAAGACTTCAACGGACTGGGTATTTAAAATAATTGCCTATTGAGAG
TTTTTAGATAGCAAGCTTTTGGGAACACATACAATAATAGTTATTTTCTCATGGATTCTTANGGGGAGAAATATTTAATA
GTTGGCTTTAAGGCTCAGANGATAGGCCNGGCAGTGGTGGTGCATGCCTTTAATCCCAGCANNNNNNAGGCNGANTCNAG
CAGANTTCTGAGTTNNNNGTCNNCCTGGTCTACNNANTGANTTANCTTTTGNANANTTNCNTGCTNCTCACNNAGAANAN
GCCCCAANGANTNNTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es