Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0224
Clone ID AL0224
Vector pGT0lxr
Project sanger

Sequence tag AL0224
Sequence
TCAGGATATGGTCTCAAAGGGCTTTGCACACCCAGATCCTCTCTGTATTCCATTTAAAGAAGTAGCAGTGAGCCTGATCC
TACCAGATGGCAGAGAGTCCTGATGTTCTTTGTGTCCAGATGTTGCAAGGTTGTGCCATGCAAGTCTTGGATAAACTAGA
GAAGAACGCCACTGAGGCAGACCCCAAGGAAACAGCCCCTAGGCTCCCCACATTCCTGCTGATGAACCTGCTGTCCCTGG
CTGGGGATGTGGCTCTACAGCAGCTGGTGCATTTGGAACAAGCAGTGAGTGGAGAGCTGGGTCGGCGGCGAGTTCTGCGA
GAGGAGCAGGAGCACAGGGCCAAGGAGCCCAAGGAGAAG
Sequence Type mRNA
Unitrap ID UNI2700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125123008..125123638 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038252 (Ncapd2) NM_146171 non-SMC condensin I complex, subunit D2 Gene [Source:MGI Symbol;Acc:MGI:1915548]

 
Come back to gene ENSMUSG00000038252


For any suggestions or comments, please send an email to unitrap@crg.es