Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3681-NR
Clone ID PST3681-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3681-NR
Sequence
GAAGGAACCCGCGCTCTAGTGCTCACTTGGGTCTTCAGCCACTCACGCGGCTCCCTTCTGGGTCACCCAGCCGCAGAGCC
CTAGCCTAGAACCAGGCGTTCCAAGGGAGAGGAGAGTGCGGATCGCCGCCGTGAGAGAGGTGAGTGGAAGAGCGCGTTCT
ATGCACACAGTGGCACGCGGGGCACCACGCAAAACTGAAAGGAACCCTTCTCACACAAGGCTGCGGGGGCTTGCTTCAGG
GGATCCGATGGGTGTCTTCTACGCTTAGCCCTCT
Sequence Type genomic DNA
Unitrap ID UNI15335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56442846..56443119 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es