Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11542E5
Clone ID IST11542E5
Vector VICTR76
Project tigm

Sequence tag IST11542E5HMF1
Sequence
CAATGGCATTATATTTTTATGTTTTNAAAACTTTATTTTANAAATATATATTGTGTTTGCCCCTGTATAATGTTTGGATA
TGAAAAGTGGATTACATTCTAGATCAGTGGTTTACAGTTGGGTGAAGTTTTGCCCCTANAAAGTTTTAGTGATATCTATA
GACATTTTTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90909867..90910041 169
NO GENE  


Sequence tag IST11542E5HMR1
Sequence
CCCAAAATNNNNCCAATTCTAGTTNCCACATAAATGTTATCATTTTTCAGTGTTTTGAATCTGAAATACTAAGACTGTAC
TCTACACTGACTGCTATCTTATAGGCTGTATGTAGTCAATAGATTTCTTACAATTCTTTGGCCCTAAGAAGCAAAGCTTC
TGCTGTGGAATTTTCTACAACCTGGACTTTGCTGATTGCGTCCCTGTGGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90910077..90910289 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es