Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0429
Clone ID GC0429
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0429
Sequence
CATCAGAGTCATTGCCAGAATCTTCAAACTGTGAATAATTTATTGGTTTTCTATTTCTGATAGGACGCACCATGGTGCCC
TGCCTAGAGCAGCAGTGCTCTGGAGCTGGGGAGCAGCTGTGGCGGTTTCAATTCCCGCCGAAAACCAGACGTCGCCCCCC
ACCCCCCC
Sequence Type mRNA
Unitrap ID UNI263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 126885971..126889622 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030346 (Rad51ap1) NM_009013 RAD51 associated protein 1 Gene [Source:MGI (curated);Acc:Rad51ap1-001]

 
Come back to gene ENSMUSG00000030346


For any suggestions or comments, please send an email to unitrap@crg.es