Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0166
Clone ID AL0166
Vector pGT0lxr
Project sanger

Sequence tag AL0166
Sequence
GGGAGATGAAGGAGACCAATGGGCTGCTCACAGAGGAGCTGGAAGGTCTGCAGAGGAAACTGAGCCGGCAGGAGAAGATG
CAGGAGGCTCTGGTTGACCTGGAGTTGGAAAAGGAGAAGCTACTTGCAAAGCTGCAGAGCTGGGAGAACCTGGACCAGAC
CATGGGCTTGAATCTCAGGACTCCAGAGGACCTTTCTAGGTTCGTGGTTGAGCTACAGCAGCGAGAGCTCACCCTGAAGG
AGAAGAATAACAGCATCACCAGCAGTGCCCGGGGTCTGGAGAAGGTCCAGCAGCAGCTCCAGGATGAGGTCCGGCAGGCC
AATGCACAGCTGCTGGAGGAGCGGAAAAAGAGGGAGACACATGAGGCACTTGCCCGAAGGCTCCAGAAGCGCAATGCATT
GCTGACCAAGGAGAGAGATGGCATGCGTGCCATCCTGGGATCCTACGACAGTGAGCTGACCCAAACTGAGTACTCAACCC
AGCTGACACAGCGCCTGTGGGAGGCCGAGGACATGGTTCAGAAGGTACATGCCCACAGCTCGGAGATGGAG
Sequence Type mRNA
Unitrap ID UNI2702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140619874..140776284 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029554 (Mad1l1) NM_010752 mitotic arrest deficient 1-like 1 Gene [Source:MGI (curated);Acc:Mad1l1-001]

 
Come back to gene ENSMUSG00000029554


For any suggestions or comments, please send an email to unitrap@crg.es