Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14662C8
Clone ID IST14662C8
Vector VICTR74
Project tigm

Sequence tag IST14662C8HMF2
Sequence
CCAGGAAGCTGCTCAAAAGGAGCCCATGTAGTCAGCAAAATTATTACACTATGTATGCCTATAAAGCTACACTAACTTTT
TCCTTCAGAAAACAATATCCACAAAGCACATGGCCCAGTACTCAGGAAGCTGAGGCAGGAGGATTACAAGTTCAAAGTCA
GCATGGGATAGACAGGAAGAAAACTCTTGTCTCAAGCAAACACAACAACAGAAAGGAATTCGAGCCTAGCTTGTGTTTCT
GTAACGTAATGAAGTACTTTAATCCTGGCTCCTCCACAACCAGGGCAATGGCCTACCCTAGGTCTGAGGGCTGCAGGGCC
TGCAGACGGGTTTTGAGGAGATCCAAAGGCTGGAAGAGGAGCGTGGAACAGGTCCCGCTGATGGAGCCGCAGAGGAAAGC
CTTAATCACTGGGTGTAACTGCGNGACAAGAGANCANGGCGTCAGCANNTCGGCCCACCACACCCAGCTCCTTTCTNCNN
ATATGCATCTGTGGTTTCTCNNNNGANANCCTTNNNGCTCCACCTGTCACAGCCCCATTCTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120025495..120026037 507
NO GENE  


Sequence tag IST14662C8BBF1
Sequence
TAAGTTTCTTGAACTGATACTACCCTATGGTTATGTAAAGTTCTTAGGACACCTCCTGAAAAATGACCATAAAGGGGCTT
GATAGGCTGGTCATGTGGGTCTGTATGCCTCCAGCATTGGGAGCTGAAGCAAGAAGATCAAGAGTTTTAAGTCAGTCTGG
TTTATGTAGTGAGACCCTGTCTTAGCCCTCACCAAGGAGGGAAAACGATCATGAGACACGATACACCAACCTACTTGGAG
GATTTAGAACAAAGTATATAGTAGTAGGGAAACAAAATACTAAATTGGAGATTCTAAAGTTCTCCATTGTTGTGTTTTTT
TTTCTATANNNNNTGAGTTTCCATTCTGAGTTCTNAATTTTGACAGCAAAAGCCTTTGCTTCTAAGCTATCTNAACAGCC
CTANTNNTNGACTGTGCNTGGTGGCANANGNNNNNATTGANGCNNAAAANNNNNAAGTTCANGGTCTTCTCCNNCCCANC
NTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14662C8HMR1
Sequence
CTGGCTGACATTTGCCTTTCTCCTGTGCTAGCTTGCATTATTAGAACTGTGCTGCCTGGAATTGGGTTTTGTGGAAGTAA
CATCCATTTTAAATGTGTGTTTTGTGTCTCTTGGCAATATGGGAACTACACAAAGTGTCTGCAAGTGGAATTTATCCCAT
TGCTTGTGGTGTGAATAGATGGTGAAC
Sequence Type genomic DNA
Unitrap ID UNI19955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120026034..120026219 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032519 (Slc25a38) NM_144793 solute carrier family 25, member 38 Gene [Source:MGI Symbol;Acc:MGI:2384782]

 
Come back to gene ENSMUSG00000032519


For any suggestions or comments, please send an email to unitrap@crg.es