Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1000-1
Clone ID PST1000-1
Vector U3NeoSV1
Project escells

Sequence tag PST1000-1
Sequence
GGCCNCTNNGATGTCTTTAGNCNCNCCAGAANAGGGCATCAAGATCCCATNCAGGTGGTTGTGAGTCACCATGTGGTTGC
TGAGAATTGAACTCAGGACCTCTGGAAAAAGCAGTCAGTGCTCTAACCACTGAGCCATCTCTCCAGCCCTTGGGTTTTTT
TTTTTTAATAGGGTGGTTTTTGATTGTTGTTTATTTTCTCTAACTCCGGCTGTCCTGGAACTAAGCTCTGTAGATCAGGC
TGACCTCAACCTGACAGCCTGCCTCTACCTCCTTAGTGCTGGGATTAAANTCCTGTACAGCCACCAACCAGCAATTTTCT
GGGAGTTTTGTTTGGTGTATGTGTGATGTGTTAGAATCACTCATGCAGGCTAAAGGAAATACTCTACCACTGAGTTACAT
CGGATAACCCTAAAGCCTGGAGGTTTCTTGTATACTTTCATGGTAGGTAAC
Sequence Type genomic DNA
Unitrap ID UNI14914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48292464..48292906 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058550 (Dppa4) NM_001018002 developmental pluripotency associated 4 Gene [Source:MGI Symbol;Acc:MGI:2157525]

 
Come back to gene ENSMUSG00000058550


For any suggestions or comments, please send an email to unitrap@crg.es