Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14643C6
Clone ID IST14643C6
Vector VICTR74
Project tigm

Sequence tag IST14643C6HMF1
Sequence
GTAAGAAATAGAGAAAAAACCCACCAGGGTCCTGCTCTAACCACACACACACACACACACACACNCNNGTGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14643C6HMR1
Sequence
TANNNNTTCTTCCTTGACACAGGGTCTCATTGAATCTGAAGCACCCTGCCTTTTAGGCCANACTGG
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987111..30987170 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14643C6BBF2
Sequence
GTAAGAAATAGAGAAAAAACCCACCAGGGTCCTGCTCTAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987175..30987216 42
NO GENE  

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es