Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10051H12
Clone ID IST10051H12
Vector VICTR75
Project tigm

Sequence tag IST10051H12HMF1
Sequence
CTACTCTCTCCAAAGAACAGAGCTTCTAAAAGCTAATTTTCCTTCTTTCTTGAAAGAAAAAGAAAGGTCCTGGAGAAGTG
CCTCTTTAAGCAATATTTACTTTTAGTGGGCTCCTGCTAATCAAACAAAAGATATTAAAAAAGGTTTTATGAAAAATATA
TTTGGTGATTTCACAGTAATTGCTTTGTTTAAAGAAAGATGCTTAAGAAAAACATATTTAATGGGATCAGTAATTGGATA
AATTCTGATGTGTTTGGGAAAATCCCTCCTCTCTTTGATAAATCATTAAAATTCTGTTCAGATAAATGTGTTTTGACTTG
CAATTCCNATCATAGAATGAGCTATTTCCTAACGCTGCTAGGGAAGTGGAACAAGGGTGACCCCAGAGCCNGANNGAGGA
CCCANGNNTACTTGACAAGGGTAAGTCTCCTGTCAATCAAAGCCCAGCACTCAGTACTCTCATGGACATGCCCCAAAACT
GTGNNAAACTTCTTTCCTTNNNAAAACATCNGCTTNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91278343..91278857 489
 
EST/CDNA Est Name
  BI739797.1 - CK780515.1 - CB183766.1 - CB057336.1 - CB523593.1 - CX225879.1 - CV560978.1 - BQ944417.1 - CF105948.1 - CK791763.1 - BU923297.1 - BB656601.1 - BU515139.1 - CX222983.1 - CX732322.1 - BE651349.1 - BU939508.1 - BB853864.1 - CA891982.1 - BB644527


Sequence tag IST10051H12BBR1
Sequence
GTAGGAGCCTTTTTCTGGCCGTCCAGTTGTGTAGCTCAAGGTCTTATTAAAGCTATGTTCTGGCCCTGAGATTACAGATG
ATTGTGATAACACAGATTCGGCTCCCGTAATCGAAAACAAATTTGTTTGTGCCTCAGGATGTCACCAGGTGTTAATTAAT
CTCAGGTTTCTCTCACCTGGACAACTCTTTAGGCTCCGGTAAACAGACGTCTGCCAGGGAGAGACAGACCTGTGTCACAT
CGTTGGTTTGTGTTTTTGGAAGGTGCCCTTTGGTGGCCCTGCACTGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI17458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91278056..91278346 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]

 
Come back to gene ENSMUSG00000040591


For any suggestions or comments, please send an email to unitrap@crg.es