Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15097D3
Clone ID IST15097D3
Vector VICTR80
Project tigm

Sequence tag IST15097D3HMF1
Sequence
CATGTTGCCAACTCAACAGTCCTTGAAGCCCTGCTCAATCATCAGCTTCAAAGAAGCTCCATGAAGGGTTTAGCTTTTCC
CGGAGCTTTGGTTCGTAGTATTGAAAGGTCTCAAATGTGATTTCTTATTTAACATCANAGAGTGTGGCAGGGTCTGAAGG
GAGAAGAGGGGACTTCAGAAGGCATGGAAAGGCAAGGAAATTTGTTTTAATTTGAGAAAGGAAATGAGTCAGGGAGTGAG
GGGGAAATCTAGAGGGAGAAGGGAAGTATGGAAGAAATGCNNCTGAGGTGCAN
Sequence Type genomic DNA
Unitrap ID UNI14410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103949439..103949730 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032679 (Cd59a) NM_007652 CD59a antigen Gene [Source:MGI (curated);Acc:Cd59a-001]

 
Come back to gene ENSMUSG00000032679


For any suggestions or comments, please send an email to unitrap@crg.es