Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10896C12
Clone ID IST10896C12
Vector VICTR76
Project tigm

Sequence tag IST10896C12HMF1
Sequence
ANAGGCAAATACAGGAAAAACAAGCCAGCGATGGTGGCACACTCCTTTAATCCCAGCACTAGGGAGGTANAGGCAGGCAG
AGATTTCTGAGTTCGAGGCCAGCCTGGTCCACAGAGTGAGTTCCAGGACAGCCAAGGGCTACACTCTGTCTCAAAAGAA
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30692398..30692553 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]


Sequence tag IST10896C12HMR1
Sequence
AAGGGATGTTACATCACCTAGGGTTACAGACAGATTTGTGAGCTGGGAACAGAACTCCGGTCCTAGGCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30692316..30692385 70
NO GENE  

 
Come back to gene ENSMUSG00000058402


For any suggestions or comments, please send an email to unitrap@crg.es