Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11703G10
Clone ID IST11703G10
Vector VICTR76
Project tigm

Sequence tag IST11703G10BBF1
Sequence
GTTTTGGTTTCTCTTTGTAGCCCTGGCTGTCCTAACTCACTTTGTGGATAGGCTGGCCTCAAACTCAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI27774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75112604..75112678 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]


Sequence tag IST11703G10HMF1
Sequence
GTTTTGGTTTCTCTTTGTAGCCCTGGCTGTCCTAACTCACTTTGTGGATAGGCTGGCCTCAAACTCAGAGATCTGCCTGC
CTCTGCCTCCCAAGTGCTGGGATTAAATGCCACCACCATCTGGA
Sequence Type genomic DNA
Unitrap ID UNI27774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75112556..75112678 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es