Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11583D2
Clone ID IST11583D2
Vector VICTR76
Project tigm

Sequence tag IST11583D2HMF1
Sequence
ATTACAGACACGGATCCCTGTAAAATCATTGCAGTTATGAAGGAACAACTACAGAAAAAAGCATGCAATTGCAAAAACTA
NTCCTGTAAGCACAGCCATTTGCTTTTAAAGGTTCTGGATGGGCCCATCTGTAAAAGACATGCACCACACATTCTGTTTC
ACCTGACATTGTAGTGCTTATNNTATTTTTGTGAACAAGGAGGAGGAAATGAANGTGATCATATCATTTGGGGCTAANGG
TTGGTGGGTACNANCCAAGGTATCCAACTCANNTTTGGCTCAGGACCAGGGGCCACANGCATNTTGNGTCTTTTTTTGTT
TGTTTGTTTTTGGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGTCCTGGAACTCACTTTGTAGACCAG
GCTGGCTCGAACTCNNAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCACCACCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96826874..96827345 444
 
EST/CDNA Est Name
  CK793137.1 - BY751349.1 - BB640999.1 - CK625135.1 - BB645386.1 - BP765917.1 - BB622755.1 - BG802875.1 - BB658357.1 - BU840816.1 - CV783214.1 - BX514039.1 - BY245563.1 - BB861764.1 - BY275643.1 - CJ088721.1 - BB849244.1 - BY133660.1 - D76669.1 - AI594990.1


Sequence tag IST11583D2HMR1
Sequence
ANTATCCTAGAATCTATGTGTCCACTGCGCANAACCATCCACTGGCCTCCCAGTTGGCAGCATCGCAGGATCACCCTTGT
TCTGCTGCATCTCATGGCTTGGGGCCTGGTGACCACTGAAGGCACTGTGTTGCTTCC
Sequence Type genomic DNA
Unitrap ID UNI15411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96826740..96826874 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es