Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10609H5
Clone ID IST10609H5
Vector VICTR76
Project tigm

Sequence tag IST10609H5HMF1
Sequence
GTTACGAGATTCTGTTTTTAAATTAACAACCTATATAAACTAATTNNNAAAACAAAAAAGAATTTATAAATCTATACAAC
TTTAAAATTACAAGCTCATACAATTACAATCTTATACTAGAAAGCCATATGTACTCTTGACTTATAAAGAGAACATTATT
TTAATCCAACTGCCTANAAGCTACTATGAAGTGTNANATTGAATGACAGAAGGAAAGAAAAAAATTAAGTCCAAAATGTT
CCTTANAAAGTCAGACAAAAGATAGGGCCAGATGGGCCCAGTTTTAAACTACAAAGGAACACTGAAAAGTAGTGGTANAA
ATATTTCAAAATTGAAACCACAACTAATCTTACATTAGTTTCTTCAAAGACCCAGAAGCAATCTTAATTGCAAATNAAGG
TANCCNACATTCCAAGAAAAATGCAACCTTCCAAGCATTGAANGTAAGTTTGGCTAATTATTATAAAAACACTGNCTTAN
CAACAGACANGGGNNANNNNGANTTGANTGTAAAGTNNGCANANCNANCNGTTCTCTCTGATTNNGCACAGGCNCGACAG
CTGNNAAAGTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10609H5HMR1
Sequence
GTAACTGAAGANACTTTAAAGGACAAGTACTCCCACATCTCACCCAAGAACAAATGTTCTTCCNCACAGTGCTTGTTTTA
NCAGTTAGAATTCACTCTCCCAAAACAGCTTGTTTTTGTCCAGTGTATTTATTTAGTGAGTGTTGCTTTTCTATTTGAGG
ATTTACCTCCCATTTTTGGATCCAGACATCTAGGTGGTGGTGATTTCTAAAAACTAGACACCTGTGATGTTAATGCACGT
GAAGCCTGANTANNAGGAAGACCGGANCCGGCATGGTGATGAGGTTGANGANTGN
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525944..35526237 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es