Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15062F7
Clone ID IST15062F7
Vector VICTR80
Project tigm

Sequence tag IST15062F7HMF1
Sequence
GTTTATTTAATGTTTTATTGATTTTTATGTAATTTTGTGGGGGAAAGTGATGCCAGTCTTTTTCATTGCCTGTATTATAG
CTTTTCTTCTGTAACATGAATGTTTGAAAAGTCCTAGGCTGAAATGAACCCTTCGTGCAGGTGTGGTTA
Sequence Type genomic DNA
Unitrap ID UNI35106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179804353..179804500 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039086 (Ss18l1) NM_178750 synovial sarcoma translocation gene on chromosome 18-like 1 Gene [Source:MGI (curated);Acc:Ss18l1-001]

 
Come back to gene ENSMUSG00000039086


For any suggestions or comments, please send an email to unitrap@crg.es