Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST424-1
Clone ID PST424-1
Vector U3NeoSV1
Project escells

Sequence tag PST424-1
Sequence
AAAAAAGNCAGCNNNANCTGTTAGNNNGNAAAAAAAAATNNNAAAAAAAANCCCCCACACCCTCCCTCACCTCTCATTAT
CCCTTCCACACTGCTTACCCGGTCTGATTCCTGCTAACCCTCTAATCTCCTATCTCTGCCTGTCTGACTCTACCACTCAG
CTTTTCCCTTCNNNCCCCCACTTCTGCCTGCATCTCTCTGGGC
Sequence Type genomic DNA
Unitrap ID UNI10754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55191597..55191748 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]

 
Come back to gene ENSMUSG00000022178


For any suggestions or comments, please send an email to unitrap@crg.es