Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10049A2
Clone ID IST10049A2
Vector VICTR75
Project tigm

Sequence tag IST10049A2HMF1
Sequence
TTGATCTGAGCCAAAAAAACAAAACAAAACAAAAAGTCATTTAGTCCCAGGAGAGTGATACTGAATATATGAGATACCGT
AGGATAATCTGTTGGAAATTCAAACTCACTAAATTTTGAACAAAATCAGGAACAAGGTTTTACGTTACGGTTACAGTGCA
TTTGTGACACTACAAAAGCCTGTGTGTATTAATTTAGGGCCACTGGCCTAAAGAGACAAGCTCAATCCTGTTGGGTTTGG
GAGAGCATTCTTGAAGGTTTTAATGTAAGAGAGCAGTGCTGTGGCTCGCCCCAGGCACTCCAGGACCCAGAGGTACAGCT
GATAACATCTGAAAATCAGCCCTTCGAGTCCTGTCCTCTGTCACAGGCCTCTTTATCTCTGATTGCAGAAGCATCTTCCT
TAAGCACTGGGGAGCCTAAAAGCCTTGGGGGTGTACCACAGTGAAACTGAGGGGCCTGGGAAAGTAGCAAAGTTCTGGCC
TAGCAAGGGCGAGGGGTGGGGGATGGGGCATGGGGTTGAAGGTGGTGTTTAATCCTGTCGCCATACACAAACAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84848543..84849096 552
NO GENE  


Sequence tag IST10049A2BBR1
Sequence
ATCAAATATGTGGTCATTTCTGTTTTGGACAAAGAAATAGAGAATGGGAAGATGAACAGAAAGTAACACAGGAGCAAAAC
ATAGCAGCGTAGCCCTGGGTGGGGAAAGGAAGTGGAGGCAGATAAGTGAAGCCCTGGGACATACTGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84849092..84849242 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es