Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12235H4
Clone ID IST12235H4
Vector VICTR76
Project tigm

Sequence tag IST12235H4HMF1
Sequence
ACTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCTCATTACAGATGGTTGTGAGCCATCATGTGGTT
GCTGGGATTTGAACTCAGGACCTTCGGAGGAGTAGTCAGTGCTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102207148..102207276 129
NO GENE  


Sequence tag IST12235H4BBF2
Sequence
ACTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI11053 UNI29225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16915506..16915553 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102207229..102207276 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98717120..98717167 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 88445638..88445685 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8552425..8552472 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89053225..89053272 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042747 (Krtcap2) NP_079603 keratinocyte associated protein 2 Gene [Source:MGI (curated);Acc:Krtcap2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149184540..149184587 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041313 (Slc7a1) NM_007513 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 Gene [Source:MGI (curated);Acc:Slc7a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 34692604..34692651 48
NO GENE  

 
Come back to gene ENSMUSG00000041313


For any suggestions or comments, please send an email to unitrap@crg.es